Notices
Results 1 to 1 of 1

Thread: Primer and PCR

  1. #1 Primer and PCR 
    Forum Freshman
    Join Date
    Jan 2011
    Location
    United Kingdom
    Posts
    7
    pBR322 sequence with EcoRI cloning site GAATTC is identified in brackets. Primers are identified in brackets too

    TCTCATGAGC GGATACATAT [primer 1]TTGAATGTAT TTAGAAAAAT[primer 1] AAACAAATAG GGGTTCCGCG
    CACATTTCCC CGAAAAGTGC [primer 2]CACCTGACGT CTAAGAAACC] ATTATTATCA TGACATTAAC
    CTATAAAAAT AGGCGTATCA [primer 3]CGAGGCCCTT TCGTCTTCAA[/size] [EcoRI cloning site]GAATTC[EcoRI cloning site] TCAT GTTTGACAGC
    TTATCATCGA TAAGCTTTAA TGCGGTAGTT TATCACAGTT AAATTGCTAA CGCAGTCAGG
    CACCGTGTAT GAAATCTAAC [primer 4]AATGCGCTCA TCGTCATCCT[/size] CGGCACCGTC ACCCTGGATG

    4 primers - 2 reverse and 2 forward

    I have identified primer 1 and 2 as forwards and primer 3 and 4` as reverse

    Primer 1: 5 TTGAATGTATTTAGAAAAAT 3
    Primer 2: 5 CGAAAAGTGCCACCTGACGT 3
    Primer 3: 5 TTGAAGACGAAAGGGCCTCG 3
    Primer 4: 5 AGGATGACGATGAGCGCATT 3


    If I used this plasmid to code a 100bp cDNA fragment what would the size of my cDNA be if I use it as a template (where do I start and begin)

    and how on earth do I use 2 of the primers above to amplify a PCR plasmid sequence containing the 100 bp CDNA as well as a third primer as an internal primer

    from what I gather the rules concerning primers are that GC rich areas and multiple sites are a NO NO which all my primers have and I take the 5' position of the forward primer and the 3' position of the reverse primer to make the internal primer. Am I missing any rules here?

    Help


    Reply With Quote  
     

  2.  
     

Bookmarks
Bookmarks
Posting Permissions
  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •